ZooKeys 181: 79–93, doi: 10.3897/zookeys.181.2932
A new sexannulate species of Orobdella (Hirudinida, Arhynchobdellida, Orobdellidae) from Yakushima Island, Japan
Takafumi Nakano 1,†
1 Department of Zoology, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan

Corresponding author: Takafumi Nakano (nakano@zoo.zool.kyoto-u.ac.jp)

Academic editor: F. Govedich

received 13 February 2012 | accepted 3 April 2012 | Published 6 April 2012


(C) 2012 Takafumi Nakano. This is an open access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.


For reference, use of the paginated PDF or printed version of this article is recommended.

Abstract

A new sexannulate species of the genus Orobdella Oka, 1895, Orobdella mononoke sp. n., is described on the basis of five specimens collected from Yakushima Island, Japan. Orobdella mononoke sp. n. differs from other sexannulate Orobdella species in its possessing the following combination of characters: dorsal surface bicolor in life, I–XIII, XXVII and caudal sucker grayish purple, XIV–XXVI amber, male gonopore at XI c11/c12, female gonopore at XIII b2, 8 + 1/2 between gonopores, tubular but bulbous at junction with crop gastroporal duct, epididymides in XV–XIX, and atrial cornua ovate. Phylogenetic analyses using nuclear 18S rDNA and histone H3, and mitochondrial COI, tRNACys, tRNAMet, 12S rDNA, tRNAVal and 16S rDNA markers show that Orobdella mononoke sp. n. is closely related to Orobdella esulcata Nakano, 2010 from Kyushu, Japan, and two species, Orobdella dolichopharynx Nakano, 2011 and Orobdella shimadae Nakano, 2011, from the Ryukyu Archipelago, Japan.

Keywords

Hirudinida, Hirudinea, Orobdellidae, Orobdella, new species, molecular phylogeny, Japan

Introduction

The genus Orobdella Oka, 1895 consists of nine terrestrial gastroporous leeches described from Japan (Nakano 2010, 2011a, b, 2012; Oka 1895; Richardson 1975). The genus Orobdella was formerly a member of the family Gastrostomobdellidae (Oceguera-Figueroa et al. 2011; Richardson 1971, 1975; Sawyer 1986), but a recent molecular phylogenetic study indicated that this genus belongs to the monotypic family Orobdellidae under Erpobdelliformes (Nakano et al. 2012).

The nine Orobdella species are split into three groups based on their mid-body somite annulation (Nakano 2012, Nakano et al. 2012): 1) the quadrannulate group containing five species; 2) the sexannulate containing three species; and 3) one octannulate species. Among these groups, the sexannulate Orobdella species consist of Orobdella ijimai Oka, 1895 from Honshu, Japan, and two species, Orobdella dolichopharynx Nakano, 2011 and Orobdella shimadae Nakano, 2011, from the Ryukyu Archipelago, Japan. Recently, sexannulate Orobdella specimens were collected from Yakushima Island. These specimens are clearly distinguishable from the other three sexannulate species. Orobdella leeches from Yakushima Island are thus described as a new species herein. In addition, its phylogenetic position is estimated using nuclear 18S rDNA and histone H3, and mitochondrial COI and tRNACys, tRNAMet, 12S rDNA, tRNAVal and 16S rDNA (tRNACys–16S) sequence data.

Material and methods

Leeches were collected from Yakushima Island, Japan (Fig. 1), under rocks along mountain or forest trails. Altitude and coordinates for localities were obtained using a Garmin eTrex GPS unit.

Botryoidal tissue was taken from every specimen for DNA extraction, and the rest of the bodies were fixed in 10% formalin and preserved in 70% ethanol. Two measurements were made: body length (BL) from the anterior margin of the oral sucker to the posterior margin of the caudal sucker, and maximum body width (BW). Examination, dissection, and drawings of the specimens were accomplished under a stereoscopic microscope with a drawing tube (Leica M125). Specimens used in this study have been deposited in the Zoological Collection of Kyoto University (KUZ).

The numbering convention is based on Moore (1927): body somites are denoted by Roman numerals, and annuli in each somite are given alphanumeric designations.

Figure 1.

Map showing the northern and the central parts of the Ryukyu Archipelago, Japan.

Figure 1.

Map showing the northern and the central parts of the Ryukyu Archipelago, Japan.

PCR and DNA sequencing

The extraction of genomic DNA followed Nakano (2012). Primer sets used in this study are listed in Table 1: for 18S, A and L, C and Y, and O and B (Apakupakul et al. 1999); for histone H3, H3aF and H3bR (Colgan et al. 1998); for COI, LCO1490 and HCO2198 (Folmer et al. 1994), and LCO-in (Nakano 2012) and HCO-outout; for tRNACys, tRNAMet, 12S, tRNAVal and 16S (tRNACys–16S), 12SA-out and 12SB-in, and 12SA-in and 12SB-out (Nakano 2012). All amplification reactions were performed using a GeneAmp PCR System 2700 (Applied Biosystems) or a MyCycler (Bi-Rad Laboratories) using an Ex Taq Polymerase Kit (Takara Bio Inc.). Only for primer set O and B of 18S, 10% DMSO was included in mixtures. Reaction mixtures were heated to 94°C for 5 min, followed by 35 cycles of 94°C (10 s), 42.5°C for 18S, COI and tRNACys-16S or 53°C for histone H3 (20 s), and 72°C (42 s for 18S, 21 s for histone H3, 1 min 13 s for COI, and 1 min for tRNACys–16S) and a final extension at 72°C for 6 min. The amplified DNA fragments were purified using polyethylene glycol (20% PEG 6000) precipitation.

Table 1.

PCR and cycle sequencing (CS) primers used in this study.

Gene Primer name Reaction Primer sequence (5’ → 3’) Source
18S
1 A PRC & CS AACCTGGTTGATCCTGCCAGT Apakupakul et al. (1999)
L PRC & CS CCAACTACGAGCTTTTTAACTG Apakupakul et al. (1999)
2 C PRC & CS CGGTAATTCCAGCTCCAATAG Apakupakul et al. (1999)
Y PRC & CS CAGACAAATCGCTCCACCAAC Apakupakul et al. (1999)
3 O PRC & CS AAGGGCACCACCAGGAGTGGAG Apakupakul et al. (1999)
B PRC & CS TGATCCTTCCGCAGGTTCACCT Apakupakul et al. (1999)
Histone H3
H3aF PRC & CS ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998)
H3bR PRC & CS ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998)
COI
1 LCO1490 PRC & CS GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCO2198 CS TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)
2 LCO-in CS TCCAGAACGTATTCCATTATTTG Nakano (2012)
HCO-outout PCR & CS TACACATCTGGATAGTCTGAAT This study
tRNACys–16S
1 12SA-out PCR & CS TTGATGAACAACATTAAATTGC Nakano (2012)
12SB-in CS TAAGCTGCACTTTGACCTGA Nakano (2012)
2 12SA-in CS AATTAAAACAAGGATTAGATACCC Nakano (2012)
12SB-out PCR & CS AACCCATAATGCAAAAGGTAC Nakano (2012)
Gene Primer name Reaction Primer sequence (5’ → 3’) Source
18S
1 A PRC & CS AACCTGGTTGATCCTGCCAGT Apakupakul et al. (1999)
L PRC & CS CCAACTACGAGCTTTTTAACTG Apakupakul et al. (1999)
2 C PRC & CS CGGTAATTCCAGCTCCAATAG Apakupakul et al. (1999)
Y PRC & CS CAGACAAATCGCTCCACCAAC Apakupakul et al. (1999)
3 O PRC & CS AAGGGCACCACCAGGAGTGGAG Apakupakul et al. (1999)
B PRC & CS TGATCCTTCCGCAGGTTCACCT Apakupakul et al. (1999)
Histone H3
H3aF PRC & CS ATGGCTCGTACCAAGCAGACVGC Colgan et al. (1998)
H3bR PRC & CS ATATCCTTRGGCATRATRGTGAC Colgan et al. (1998)
COI
1 LCO1490 PRC & CS GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCO2198 CS TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)
2 LCO-in CS TCCAGAACGTATTCCATTATTTG Nakano (2012)
HCO-outout PCR & CS TACACATCTGGATAGTCTGAAT This study
tRNACys–16S
1 12SA-out PCR & CS TTGATGAACAACATTAAATTGC Nakano (2012)
12SB-in CS TAAGCTGCACTTTGACCTGA Nakano (2012)
2 12SA-in CS AATTAAAACAAGGATTAGATACCC Nakano (2012)
12SB-out PCR & CS AACCCATAATGCAAAAGGTAC Nakano (2012)

All samples were sequenced in both directions. Sequencing reactions were performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Each sequencing reaction mixture was incubated at 96°C for 2 min, followed by 40 cycles of 96°C (10 s), 50°C (5 s), and 60°C (42 s for 18S, 21 s for Histone H3, 45 s for COI, and 40 s for tRNACys-16S). The products were collected by ethanol precipitation and sequenced on an ABI 3130xl Genetic Analyzer (Applied Biosystems). The obtained sequences were edited using DNA BASER (Heracle Biosoft S.R.L.). In this study, the following DNA sequences were newly obtained and deposited in GenBank (Table 2): 1) 18S sequences from the holotype (KUZ Z224) of the new species, the holotype (KUZ Z156) of Orobdella koikei Nakano, 2012 and the topotype (KUZ Z181) of Orobdella octonaria Oka, 1895; 2) histone H3 sequences from ten Orobdella species, Erpobdella japonica Pawłowski, 1962 (Erpobdellidae), Gastrostomobdella monticola Moore, 1929 (Gastrostomobdellidae) and Mimobdella japonica Blanchard, 1897 (Salifidae); 3) COI and tRNACys–16S sequences from the holotype (KUZ Z224) and two of the paratypes (KUZ Z221, 223) of the new species. Among the new species, DNA sequences of the holotype (KUZ Z224) were analyzed in the present study. The other DNA sequences were taken from GenBank (Table 2).

Table 2.

Samples used for the phylogenetic analyses. The information on voucher, collection locality, and GenBank accession numbers is indicated. Acronym: UNIMAS, the Universiti Malaysia Sarawak. Sources: aNakano (2012), bNakano et al. (2012).

Species Voucher 18S Histone H3 COI tRNACys–16S
Orobdella esulcata KUZ Z29 Holotype AB663655b AB698873 AB679664a AB679665a
Orobdella dolichopharynx KUZ Z120 Holotype AB663665b AB698876 AB679680a AB679681a
Orobdella ijimai KUZ Z110 Topotype AB663659b AB698877 AB679672a AB679673a
Orobdella kawakatsuorum KUZ Z167 Topotype AB663661b AB698878 AB679704a AB679705a
Orobdella koikei KUZ Z156 Holotype AB698883 AB698882 AB679688a AB679689a
Orobdella mononoke sp. n. KUZ Z221 AB698862 AB698863
Orobdella mononoke sp. n. KUZ Z223 AB698864 AB698865
Orobdella mononoke sp. n. KUZ Z224 Holotype AB698868 AB698869 AB698866 AB698867
Orobdella octonaria KUZ Z181 Topotype AB698870 AB698871 AB679708a AB679709a
Orobdella shimadae KUZ Z128 Holotype AB663663b AB698875 AB679676a AB679677a
Orobdella tsushimensis KUZ Z134 Holotype AB663653b AB698872 AB679662a AB679663a
Orobdella whitmani KUZ Z45 Topotype AB663657b AB698874 AB679668a AB679669a
Erpobdella japonica KUZ Z178 AB663648b AB698879 AB679654a AB679655a
Gastrostomobdella monticola UNIMAS/A3/BH01/10 AB663649b AB698880 AB679656a AB679657a
Mimobdella japonica KUZ Z179 AB663650b AB698881 AB679658a AB679659a
Phylogenetic analyses

Histone H3 and COI sequences were aligned by eye since there were no indels. Nuclear 18S and mitochondrial tRNACys–16S sequences were aligned using MAFFT X-INS-i (Hofacker et al. 2002; Katoh and Toh 2008; McCaskill 1990; Tabei et al. 2008) taking into account RNA secondary structure information, and then refined with GBLOCKS (Castresana 2000). The length of aligned sequences of 18S was 1787 bp, that of histone H3 was 327 bp, that of COI was 1266 bp, and that of tRNACys–16S was 787 bp. The concatenated sequences thus yielded a total of 4167 bp positions.

Phylogenetic trees were constructed using maximum likelihood (ML) and Bayesian inference (BI). ML phylogenies were calculated using TREEFINDER v October 2008 (Jobb et al. 2004) with the tool package PHYLOGEARS v 2.0 (Tanabe 2008), and then non-parametric bootstrapping (Felsenstein 1985) was conducted with 500 replicates. The best-fit models for each partition were selected using the Akaike Information Criterion (Akaike 1974) by using KAKUSAN4 (Tanabe 2011): for 18S, the Jobb 2008 model (J2) with gamma distribution (+G) and proportion of invariant sites (+I) was selected; for the 1st position of histone H3, the Tamura-Nei model (TN93); for the 2nd position of histone H3, the Jukes-Cantor model (JC69); for the 3rd position of histone H3, J2+G; for the 1st position of COI, TN93+G+I; for the 2nd position of COI, the transversion model (TVM)+I; for the 3rd position of COI, the transition model (TIM)+G; and the general time reversal model (GTR)+G was selected for tRNACys–16S. BI and Bayesian posterior probabilities (BPPs) were estimated using the MPI version of MRBAYES v 3.1.2 (Altekar et al. 2004; Huelsenbeck et al. 2001; Ronquist and Huelsenbeck 2003). The best-fit models for each partition were identified using the Bayesian Information Criterion (Schwarz 1978) also by using KAKUSAN4: for 18S, the Kimura 1980 model (K80)+I; for histone H3 1st and 2nd position, JC69; for histone H3 3rd position, the Hasegawa-Kishino-Yano model (HKY85)+G; for COI 1st position, GTR+I; for COI 2nd position, the Felsenstein 1981 model (F81)+I; for COI 3rd position, HKY85+G; and for tRNACys–16S, GTR+G. Two independent runs for four Markov chains were conducted for 7 million generations and the tree was sampled every 100 generations. Based on checking the parameter estimates and convergence using TRACER v 1.5 (Rambaut and Drummond 2009), the first 15, 001 trees were discarded.

The nodes with bootstrap value (BS) higher than 70% were regarded as sufficiently resolved (Hillis and Bull 1993). Nodes with BPP higher than 95% were considered statistically significant (Leaché and Reeder 2002).

Systematics Genus Orobdella Oka, 1895

urn:lsid:zoobank.org:act:FA8333ED-8C17-41FD-AFC1-62A4F98D4AC1

Diagnosis.

In life, dorsal surface of somites I–XIII, XXVII and caudal sucker grayish purple and of somites XIV–XXVI amber, ventral surface grayish white. Somite VI quadrannulate on dorsal, b1 = b2 < a2 = a3, and triannulate on venter, a1 = a2 = a3. Somite VII quadrannulate, somites VIII–XXV sexannulate, somite XXVI quinquannulate. Pharynx reaching to XIV. Gastropore conspicucous at XIII b2 (slightly anterior to middle of annulus). Gastroporal duct, winding at junction with gastropore, tubular but slightly bulbous at junction with crop. Male gonopore at XI c11/c12, female gonopore at XIII b2, behind gastropore, gonopores separated by 8 + 1/2 annuli. Paired epididymides in XV–XIX (approximately four somites). Atrial cornua developed, ovate.

Type materials.

KUZ Z224, holotype, dissected, collected from under a rock along a mountain trail at Shiratani–unsuikyo, Yakushima, Kagoshima Pref. (Yakushima Island), Japan (30°22.78'N, 130°34.49'E; Alt. 648 m), by Takafumi Nakano on 29 October, 2011.

Four paratypes collected from under rocks along mountain trails in Yakushima, Kagoshima Pref. (Yakushima Island), Japan, by Takafumi Nakano. Two specimens from the type locality: KUZ Z221 (30°22.87'N, 130°34.68'E; Alt. 649 m), dissected, on 28 October, 2011, and KUZ Z225 (30°22.75'N, 130°34.49'E; Alt. 646 m), on 29 October, 2011. Two specimens from Kusugawa on 28 October, 2011: KUZ Z222 (30°23.76'N, 130°35.25'E; Alt. 363 m), and KUZ Z223 (30°23.75'N, 130°35.25'E; Alt. 363 m), dissected.

Etymology.

The specific name is from the Japanese animation movie title ‘Mononoke-hime (Princess Mononoke)’. The type locality of this new species is the origin of an epic forest in that movie. The specific name is a Japanese word, not a Latin or latinized word.

Description of holotype.

Body firm, muscular, elongated, gaining regularly in width in caudal direction, dorso-ventral depressed, sides nearly parallel from mid length to point just anterior to caudal sucker, BL 139.3 mm, BW 9.2 mm (Figs 2, 3). Caudal sucker ventral, oval, its diameter smaller than BW (Figs 3B, 4D). In life, dorsal surface of somites I–XIII, XXVII and caudal sucker grayish purple, and of somites XIV–XXVI amber (Fig. 2), ventral surface grayish white. Color faded in preservative, without any dark lines (Fig. 3).

Figure 2.

Orobdella mononoke sp. n., holotype, KUZ Z224, taken of live animal, dorsal view.

Figure 2.

Orobdella mononoke sp. n., holotype, KUZ Z224, taken of live animal, dorsal view.

Figure 3.

Orobdella mononoke sp. n., holotype, KUZ Z224. A Dorsal and B ventral views. Scale bar, 1 cm.

Figure 3.

Orobdella mononoke sp. n., holotype, KUZ Z224. A Dorsal and B ventral views. Scale bar, 1 cm.

Figure 4.

Orobdella mononoke sp. n., holotype, KUZ Z224. A Dorsal view of somites I–VIII B ventral view of somites I–VIII C dorsal view of somites XXV–XXVII and caudal sucker D ventral view of somites XXV–XXVII and caudal sucker E ventral view of somites XI–XIII F ventral view of gastroporal duct; and G ventral view of gastropore and female gonopore. Scale bars, 2 mm (A–F) and 0.5 mm (G). Abbreviations: an, anus; cp, crop; fp, female gonopore; gd, gastroporal duct; gp, gastropore; mp, male gonopore; np, nephridiopore; and ph, pharynx.

Figure 4.

Orobdella mononoke sp. n., holotype, KUZ Z224. A Dorsal view of somites I–VIII B ventral view of somites I–VIII C dorsal view of somites XXV–XXVII and caudal sucker D ventral view of somites XXV–XXVII and caudal sucker E ventral view of somites XI–XIII F ventral view of gastroporal duct; and G ventral view of gastropore and female gonopore. Scale bars, 2 mm (A–F) and 0.5 mm (G). Abbreviations: an, anus; cp, crop; fp, female gonopore; gd, gastroporal duct; gp, gastropore; mp, male gonopore; np, nephridiopore; and ph, pharynx.

Somite I completely merged with prostomium (Fig. 4A). Somites II and III uniannulate (Fig. 4A). Somites IV and V biannulate, (a1+a2) = a3 (Fig. 4A), V a3 forming posterior margin of oral sucker (Fig. 4B). Somite VI quadrannulate on dorsal, b1 = b2 < a2 = a3, triannulate on venter, a1 = a2 = a3 (Fig. 4A–B). Somite VII quadrannulate, a1 = a2 = b5 = b6 (Fig. 4A–B). Somites VIII–XXV sexannulate. b1 = b2 = a2 = b5 = c11 = c12 (Fig. 4A–E). Somite XXVI quinquannulate, b1 = b2 = a2 < b5 = b6, b5 and b6 with slight furrows on dorsal (Fig. 4C–D), XXVI b5 being last complete annulus on venter (Fig. 4D). Somite XXVII comprising a few furrows; anus behind it with no post-anal annulus (Fig. 4C).

Anterior ganglionic mass in VI a2 and a3. Ganglion VII in a1 and a2. Ganglia VIII–XV, XXII and XXIII in a2 of each somite (Fig. 5A). Ganglia XVI–XXI and XXIV in b2 and a2 of each somite (Fig. 5A). Ganglion XXV in b2. Ganglion XXVI in XXV c12 and XXVI b1. Posterior ganglionic mass in XXVI a2 and b5.

Eyes three pairs, first pair dorsally on posterior margin of II (Fig. 4A), second pair dorsolaterally on middle of V (a1 + a2). Nephridiopores in 17 pairs, ventrally at posterior margin of a1 of each somite of VIII–XXIV (Fig. 4B, E). Papillae numerous, minute, hardly visible, one row on every annulus.

Pharynx agnathous, euthylaematous, reaching to XIV/XV (Fig. 4F). Crop tubular, acaecate, in XIV/XV to XXI b2/a2. Gastropore conspicuous, ventral, located slightly anterior to middle of XIII b2 (Fig. 4E, G). Gastroporal duct, winding at junction with gastropore, tubular but slightly bulbous at junction with crop, joining with crop in XIV c11 (Fig. 4F). Intestine tubular, acaecate, in XXI b2/a2 to XXIV b2/a2. Rectum, tubular, thin-walled.

Male gonopore in the furrow of XI c11/c12 (Fig. 4E). Female gonopore located slightly anterior to middle of XIII b2, inconspicuous, located behind gastropore (Fig. 4E, G). Gonopores separated by 8 + 1/2 annuli (Fig. 4E). Testisacs multiple, one or two testisacs on each side in each annulus, in XIX c11 to XXV b5 (Fig. 5A). Paired epididymides in XVI b2 to XIX b5 (Fig. 5A). Ejaculatory bulbs absent. Ejaculatory ducts in XI b5 to XVI b2, loosely coiled, each winding from each junction with epididymis, narrowing at junction with atrial cornu, then turning sharply inward toward atrial cornu without pre-atrial loop (Fig. 5A–D). Pair of atrial cornua in XI b5 and c11, muscular, ovate (Fig. 5A–B, D). Atrium short, muscular, globular in XI c11 and c12 (Fig. 5B–D). Penis sheath and penis absent. Ovisacs one pair, thin-walled, globular, in XIII a2 and b5 (Fig. 5A, E). Oviducts thin-walled, right oviduct crossing ventrally beneath nerve cord, both oviducts converging into common oviduct in XIII b2 (Fig. 5A, E). Common oviduct thin-walled, short, directly ascending to female gonopore (Fig. 5E).

Figure 5.

Orobdella mononoke sp. n., holotype, KUZ Z224. A Dorsal view of reproductive system including ventral nervous system B dorsal view of male atrium including position of ganglion XI C lateral view of male atrium D ventral view of male atrium; and E dorsal view of female reproductive system including position of ganglion XIII. Scale bars, 5 mm (A) and 1 mm (B–E). Abbreviations: ac, atrial cornu; at, atrium; cod, common oviduct; ed, ejaculatory duct; ep, epididymis; gp, gastropore; o, ovisac; od, oviduct; and ts, testisac.

Figure 5.

Orobdella mononoke sp. n., holotype, KUZ Z224. A Dorsal view of reproductive system including ventral nervous system B dorsal view of male atrium including position of ganglion XI C lateral view of male atrium D ventral view of male atrium; and E dorsal view of female reproductive system including position of ganglion XIII. Scale bars, 5 mm (A) and 1 mm (B–E). Abbreviations: ac, atrial cornu; at, atrium; cod, common oviduct; ed, ejaculatory duct; ep, epididymis; gp, gastropore; o, ovisac; od, oviduct; and ts, testisac.

Variation.

In life, color generally same as holotype (Fig. 2). Somites III and IV uniannulate. Pharynx reaching to XIV b5/c11–XIV c11/c12. Crop reaching to XXI b2/a2–XXI a2. Gastroporal duct joining with crop in XIV b5; immature specimen (KUZ Z223), simple tubular. Intestine reaching to XXIV b1–XXIV b5. Testisacs in XIX b1 to XXIV c11. Epididymides in XV a2 to XVIII c11. Immature specimen (KUZ Z223), pair of atrial cornua in XI c11, fusiform. Left oviduct crossing ventrally beneath nerve cord.

Distribution.

Known from mountainous regions of Yakushima Island, Japan (Fig. 1).

Phylogenetic position.

The ML tree with ln L = -14306.80 (Fig. 6) was nearly identical to the obtained BI tree (not shown). Monophyly of the genus Orobdella was confirmed (BS = 99 %, BPP = 100 %). The genus Orobdella then divided into two clades: clade A (BS = 99 %, BPP = 100 %) consisted of two species from Hokkaido, Japan, Orobdella kawakatsuorum Richardson, 1975 and Orobdella koikei; and clade B (BS = 98 %, BPP = 100 %) included all the other Orobdella species. Clade B comprised two subclades: subclade B1 was Orobdella tsushimensis Nakano, 2011 from Tsushima Island, Japan; and subclade B2 (BS = 70 %, BPP = 100 %) was further divided into two subclades. Subclade B2a (BS = 92 %, BPP = 100 %) included Orobdella mononoke sp. n., Orobdella esulcata Nakano, 2010 from Kyushu, and two Orobdella species from the Ryukyu Archipelago, Orobdella dolichopharynx and Orobdella shimadae. Subclade B2b (BS = 73 %, BPP = 100 %) consisted of three species from Honshu, Japan, Orobdella whitmani Oka, 1895, Orobdella ijimai and Orobdella octonaria.

Figure 6.

The ML tree of 4167 bp of nuclear 18S rDNA and histone H3 and mitochondrial COI, tRNACys, tRNAMet, 12S rDNA, tRNAVal and 16S rDNA. A species name in green indicates a quadrannulate species; in red, sexannulate; and in blue, octannulate. The numbers associated with the nodes represent the bootstrap values for ML (BS)/ and Baysian posterior probabilities (BPPs). BS higher than 70% and/or BPP higher than 95% are indicated.

Figure 6.

The ML tree of 4167 bp of nuclear 18S rDNA and histone H3 and mitochondrial COI, tRNACys, tRNAMet, 12S rDNA, tRNAVal and 16S rDNA. A species name in green indicates a quadrannulate species; in red, sexannulate; and in blue, octannulate. The numbers associated with the nodes represent the bootstrap values for ML (BS)/ and Baysian posterior probabilities (BPPs). BS higher than 70% and/or BPP higher than 95% are indicated.

In subclade B2a, monophyly of Orobdella dolichopharynx and Orobdella shimadae was well supported (BS = 93 %, BPP = 100 %). However, the precise phylogenetic position of Orobdella mononoke sp. n. in the sublcade could not be determined. In the ML analysis, Orobdella mononoke sp. n. and Orobdella esulcata formed a monophyletic clade, but this clade was not supported well (BS = 30 %). In the BI analysis, Orobdella mononoke sp. n. and two Ryukyu Archipelago species formed a monophyletic clade, but this relationship was not also supported (BPP = 77 %).

Remarks.

Orobdella mononoke sp. n. differs from the three other sexannulate congeneric species, Orobdella ijimai, Orobdella dolichopharynx, and Orobdella shimadae, in the following characteristics (Table 3): 1) dorsal surface bicolor, I–XIII, XXVII and caudal sucker grayish purple, XIV–XXVI amber; 2) VI quadrannulate on dorsal; 3) VII quadrannulate; 4) VIII sexannulate; 5) gonopores separated by 8 + 1/2 annuli; 6) pharynx reaching to XIV; 7) gastroporal duct tubular but bulbous at junction with crop; 8) epididymides in XV–XIX (approximately four somites); and 9) atrial cornua ovate. Orobdella mononoke sp. n. is clearly distinguished from Orobdella esulcata, Orobdella kawakatsuorum, Orobdella koikei, Orobdella tsushimensis, Orobdella octonaria and Orobdella whitmani, in having mid-body somites that are sexannulate; they are quadrannulate in Orobdella esulcata, Orobdella kawakatsuorum, Orobdella koike, Orobdella tsushimensis and Orobdella whitmani, and octannulate in Orobdella octonaria.

Table 3.

Comparisons of morphological characters between Orobdella mononoke sp. n. and three sexannulate congeneric species.

Character Orobdella mononoke sp. n. Orobdella dolichopharynx Orobdella ijimai Orobdella shimadae
Color of dorsal surface bicolor, I–XIII, XXVII and caudal sucker grayish purple, XIV–XXVI amber yellowish green yellowish green yellowish green
Annulation of VI quadrannulate on dorsal triannulate triannulate triannulate
Annulation of VII quadrannulate quadrannulate quadrannulate triannulate
Annulation of VIII sexannulate quinquannulate sexannulate quinquannulate
Number of annuli between gonopores 8 + 1/2 8 1/2 + 7 + 1/2 9
Pharynx reaching to XIV reaching to XVI reaching to XIV reaching to XVI
Gastroporal duct tubular, but bulbous at junctions with crop tubular, reaching to XVI bulbous tubular reaching to XV
Epididymides in XV–XIX (about four somites) absent in XVI–XIX (about two and half somites) absent
Atrial cornua ovate absent ellipsoid absent
Character Orobdella mononoke sp. n. Orobdella dolichopharynx Orobdella ijimai Orobdella shimadae
Color of dorsal surface bicolor, I–XIII, XXVII and caudal sucker grayish purple, XIV–XXVI amber yellowish green yellowish green yellowish green
Annulation of VI quadrannulate on dorsal triannulate triannulate triannulate
Annulation of VII quadrannulate quadrannulate quadrannulate triannulate
Annulation of VIII sexannulate quinquannulate sexannulate quinquannulate
Number of annuli between gonopores 8 + 1/2 8 1/2 + 7 + 1/2 9
Pharynx reaching to XIV reaching to XVI reaching to XIV reaching to XVI
Gastroporal duct tubular, but bulbous at junctions with crop tubular, reaching to XVI bulbous tubular reaching to XV
Epididymides in XV–XIX (about four somites) absent in XVI–XIX (about two and half somites) absent
Atrial cornua ovate absent ellipsoid absent

The trees obtained in this study are nearly identical to those obtained in other phylogenetic analyses of the genus Orobdella (Nakano 2012; Nakano et al. 2012). However, the phylogenetic position of Orobdella mononoke sp. n. still remains uncertain. Further taxon samplings will be needed to obtain robust phylogeny of the genus Orobdella.

Orobdella mononoke sp. n. inhabits Yakushima Island, which is located in the northern part of the Ryukyu Archipelago (Fig. 1). In the Ryukyu Archipelago, two sexannulate Orobdella species have been described: 1) Orobdella dolichopharynx from Amamioshima Island; and 2) Orobdella shimadae from Okinawajima Island. These two species have the following characteristics in common: 1) long pharynx, reaching to somite XVI; 2) rudimentary gastroporal duct and absence of gastropore; 3) absence of epididymides; and 4) absence of male atrial cornua. Although Orobdella mononoke sp. n. is a sexannulate species, this species does not share such morphological characteristics. Orobdella mononoke sp. n. possesses 1) normal length pharynx for the genus Orobdella, 2) developed gastroporal duct and conspicuous gastropore, 3) epididymides in XV–XIX, 4) ovate atrial cornua. Molecular phylogenetic analyses in this study also could not show monophyly of the three species in the Ryukyu Archipelago, Orobdella mononoke sp. n., Orobdella dolichopharynx and Orobdella shimadae. These differences of morphological characteristics and molecular phylogenetic analyses suggest that Orobdella mononoke sp. n. is not closely related to Orobdella dolichoharynx and Orobdella shimadae. In vertebrates, the fauna of the Osumi Islands, in which Yaushima Island is included, is related to that of Kyushu (Toda et al. 2003). In the case of leeches, Haemadipsa japonica Whitman, 1886, which inhabits Honshu, Shikoku and Kyushu, Japan, is distributed in Yakushima Island (Itoh 2003). In islands of the Ryukyu Archipelago south of Yakushima Island, however, another species, Haemadipsa rjukjuana Oka, 1910, is distributed (Lai et al. 2011). A recent molecular phylogenetic study revealed that Haemadipsa japonica and Haemadipsa rjukjuana are not closely related species (Borda and Siddall 2011). These facts are collateral evidence that Orobdella mononoke sp. n. is not very closely related to Orobdella dolichopharynx and Orobdella shimadae. Whether or not this is true, additional inventory surveys and molecular phylogenetic studies are needed to reveal the phylogenetic relationships within and the biogeographical history of the genus Orobdella.

Acknowledgements

The author is grateful to Professor Tsutomu Hikida (Kyoto University; KU) for his helpful comments and suggestions to improve this manuscript. I am also grateful to Koshiro Eto (KU) for his help in collecting specimens in Yakushima Island, to Dr Zainudin Ramlah (UNIMAS) for permitting me to use the Gastrostomobdella specimen for molecular analyses, to Dr Elizabeth Nakajima (KU) for checking the English of this text, to two anonymous reviewers and Dr Fredric R. Govedich (Southern Utah University) for their constructive comments on this manuscript, and to Hiroshi Noda (KU) and Eri Kawaguchi (KU) for their technical support. I also express my sincere thanks to Naoki Koike (KU), Dr Kanto Nishikawa (KU) and Taku Shimada (Ant Room) for providing specimens. This study was financially supported in part by a Grant-in Aid for Biodiversity and Evolutionary Research of Global COE (A06) from MEXT, Japan, to Kyoto University.

References
Akaike H (1974) A new look at the statistical model identification. IEEE Transactions on Automatic Control 19: 716-723. doi: 10.1109/TAC.1974.1100705
Akaike H (1974) A new look at the statistical model identification. IEEE Transactions on Automatic Control 19: 716-723. doi: 10.1109/TAC.1974.1100705
Altekar G, Dwarkadas S, Huelsenbeck JP, Ronquist F (2004) Parallel Metropolis coupled Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics 20: 407-415. doi: 10.1093/bioinformatics/btg427
Altekar G, Dwarkadas S, Huelsenbeck JP, Ronquist F (2004) Parallel Metropolis coupled Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics 20: 407-415. doi: 10.1093/bioinformatics/btg427
Apakupakul K, Siddall ME, Burreson EM (1999) Higher level relationships of leeches (Annelida: Clitellata: Euhirudinea) based on morphology and gene sequences. Molecular Phylogenetics and Evolution 12: 350-359. doi: 10.1006/mpev.1999.0639
Apakupakul K, Siddall ME, Burreson EM (1999) Higher level relationships of leeches (Annelida: Clitellata: Euhirudinea) based on morphology and gene sequences. Molecular Phylogenetics and Evolution 12: 350-359. doi: 10.1006/mpev.1999.0639
Blanchard R (1897) Hirudinées du Musée de Leyde. Notes from the Leyden Museum 19: 73-113.
Blanchard R (1897) Hirudinées du Musée de Leyde. Notes from the Leyden Museum 19: 73-113.
Borda E, Siddall ME (2011) Insights into the evolutionary history of Indo-Pacific bloodfeeding terrestrial leeches (Hirudinida :Arhynchobdellida : Haemadipisdae). Invertebrate Systematics 24: 456-472. doi: 10.1071/IS10013
Borda E, Siddall ME (2011) Insights into the evolutionary history of Indo-Pacific bloodfeeding terrestrial leeches (Hirudinida :Arhynchobdellida : Haemadipisdae). Invertebrate Systematics 24: 456-472. doi: 10.1071/IS10013
Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540-552.
Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution 17: 540-552.
Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419-437. doi: 10.1071/ZO98048
Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR (1998) Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology 46: 419-437. doi: 10.1071/ZO98048
Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791. doi: 10.2307/2408678
Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783-791. doi: 10.2307/2408678
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299.
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299.
Hillis DM, Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42: 182-192. doi: 10.1093/sysbio/42.2.182
Hillis DM, Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology 42: 182-192. doi: 10.1093/sysbio/42.2.182
Hofacker IL, Fekete M, Stadler PF (2002) Secondary structure prediction for aligned RNA sequences. Journal of Molecular Biology 319: 1059-1066. doi: 10.1016/S0022-2836(02)00308-X
Hofacker IL, Fekete M, Stadler PF (2002) Secondary structure prediction for aligned RNA sequences. Journal of Molecular Biology 319: 1059-1066. doi: 10.1016/S0022-2836(02)00308-X
Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294: 2310-2314. doi: 10.1126/science.1065889
Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian inference of phylogeny and its impact on evolutionary biology. Science 294: 2310-2314. doi: 10.1126/science.1065889
Itoh T (2003) Class Hirudinea. In: Nishida M, Shikatani N, Shokita S (Eds). The Flora and Fauna of Inland Waters in the Ryukyu Islands. Tokai University Press, Hadano: 197-202.
Itoh T (2003) Class Hirudinea. In: Nishida M, Shikatani N, Shokita S (Eds). The Flora and Fauna of Inland Waters in the Ryukyu Islands. Tokai University Press, Hadano: 197-202.
Jobb G, von Haeseler A, Strimmer K (2004) TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics. BMC Evolutionary Biology 4: 18. doi: 10.1186/1471-2148-4-18
Jobb G, von Haeseler A, Strimmer K (2004) TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics. BMC Evolutionary Biology 4: 18. doi: 10.1186/1471-2148-4-18
Katoh K, Toh H (2008) Improved accuracy of multiple ncRNA alignment by incorporating structural information into a MAFFT-based framework. BMC Bioinformatics 9: 212. doi: 10.1186/1471-2105-9-212
Katoh K, Toh H (2008) Improved accuracy of multiple ncRNA alignment by incorporating structural information into a MAFFT-based framework. BMC Bioinformatics 9: 212. doi: 10.1186/1471-2105-9-212
Lai Y-T, Nakano T, Chen J-H (2011) Three species of land leeches from Taiwan, Haemadipsa rjukjuana comb. n., a new record for Haemadipsa picta Moore, and an updated description of Tritetrabdella taiwana (Oka). ZooKeys 139: 1-22. doi: 10.3897/zookeys.139.1711
Lai Y-T, Nakano T, Chen J-H (2011) Three species of land leeches from Taiwan, Haemadipsa rjukjuana comb. n., a new record for Haemadipsa picta Moore, and an updated description of Tritetrabdella taiwana (Oka). ZooKeys 139: 1-22. doi: 10.3897/zookeys.139.1711
Leaché AD, Reeder TW (2002) Molecular systematics of the eastern fence lizard (Sceloporus undulatus): a comparison of parsimony, likelihood, and Bayesian approaches. Systematic Biology 51: 44-68. doi: 10.1080/106351502753475871
Leaché AD, Reeder TW (2002) Molecular systematics of the eastern fence lizard (Sceloporus undulatus): a comparison of parsimony, likelihood, and Bayesian approaches. Systematic Biology 51: 44-68. doi: 10.1080/106351502753475871
McCaskill JS (1990) The equilibrium partition function and base pair binding probabilities for RNA secondary structure. Biopolymers 29: 1105-1119. doi: 10.1002/bip.360290621
McCaskill JS (1990) The equilibrium partition function and base pair binding probabilities for RNA secondary structure. Biopolymers 29: 1105-1119. doi: 10.1002/bip.360290621
Moore JP (1927) The segmentation (metamerism and annulation) of the Hirudinea. In: Harding WA, Moore JP. The Fauna of British India, including Ceylon and Burma Hirudinea. Taylor and Francis, London, 1–12.
Moore JP (1927) The segmentation (metamerism and annulation) of the Hirudinea. In: Harding WA, Moore JP. The Fauna of British India, including Ceylon and Burma Hirudinea. Taylor and Francis, London, 1–12.
Moore JP (1929) Leeches from Borneo with descriptions of new species. Proceedings of the Academy of Natural Sciences of Philadelphia 81: 267-295.
Moore JP (1929) Leeches from Borneo with descriptions of new species. Proceedings of the Academy of Natural Sciences of Philadelphia 81: 267-295.
Nakano T (2010) A new species of the genus Orobdella (Hirudinida: Arhynchobdellida: Gastrostomobdellidae) from Kumamoto, Japan, and a redescription of O. whitmani with the designation of the lectotype. Zoological Science 27: 880-887. doi: 10.2108/zsj.27.880
Nakano T (2010) A new species of the genus Orobdella (Hirudinida: Arhynchobdellida: Gastrostomobdellidae) from Kumamoto, Japan, and a redescription of O. whitmani with the designation of the lectotype. Zoological Science 27: 880-887. doi: 10.2108/zsj.27.880
Nakano T (2011a) A new species of Orobdella (Hirudinida: Arhynchobdellida: Gastrostomobdellidae) from Tsushima Island, Japan. Species Diversity 16: 39-47.
Nakano T (2011a) A new species of Orobdella (Hirudinida: Arhynchobdellida: Gastrostomobdellidae) from Tsushima Island, Japan. Species Diversity 16: 39-47.
Nakano T (2011b) Redescription of Orobdella ijimai (Hirudinida: Arhynchobdellida: Gastrostomobdellidae), and two new species of Orobdella from the Ryukyu Archipelago, Japan. Zootaxa 2998: 1-15.
Nakano T (2011b) Redescription of Orobdella ijimai (Hirudinida: Arhynchobdellida: Gastrostomobdellidae), and two new species of Orobdella from the Ryukyu Archipelago, Japan. Zootaxa 2998: 1-15.
Nakano T (2012) A new species of Orobdella (Hirudinida, Arhynchobdellida, Gastrostomobdellidae) and redescription of O. kawakatsuorum from Hokkaido, Japan with the phylogenetic position of the new species. ZooKeys 169: 9-30. doi: 10.3897/zookeys.169.2425
Nakano T (2012) A new species of Orobdella (Hirudinida, Arhynchobdellida, Gastrostomobdellidae) and redescription of O. kawakatsuorum from Hokkaido, Japan with the phylogenetic position of the new species. ZooKeys 169: 9-30. doi: 10.3897/zookeys.169.2425
Nakano T, Ramlah Z, Hikida T (2012) Phylogenetic position of gastrostomobdellid leeches (Hirudinida, Arhynchobdellida, Erpobdelliformes) and a new family for the genus Orobdella. Zoologica Scripta 41: 177-185. doi: 10.1111/j.1463-6409.2011.00506.x
Nakano T, Ramlah Z, Hikida T (2012) Phylogenetic position of gastrostomobdellid leeches (Hirudinida, Arhynchobdellida, Erpobdelliformes) and a new family for the genus Orobdella. Zoologica Scripta 41: 177-185. doi: 10.1111/j.1463-6409.2011.00506.x
Oceguera-Figueroa A, Phillips AJ, Pacheco-Chaves B, Reeves WK, Siddall ME (2011) Phylogeny of macrophagous leeches (Hirudinea, Clitellata) based on molecular data and evaluation of the barcoding locus. Zoologica Scripta 40: 194-203. doi: 10.1111/j.1463-6409.2010.00465.x
Oceguera-Figueroa A, Phillips AJ, Pacheco-Chaves B, Reeves WK, Siddall ME (2011) Phylogeny of macrophagous leeches (Hirudinea, Clitellata) based on molecular data and evaluation of the barcoding locus. Zoologica Scripta 40: 194-203. doi: 10.1111/j.1463-6409.2010.00465.x
Oka A (1895) On some new Japanese land leeches. (Orobdella nov. gen.). The Journal of the College of Science, Imperial University, Japan 8: 275-306.
Oka A (1895) On some new Japanese land leeches. (Orobdella nov. gen.). The Journal of the College of Science, Imperial University, Japan 8: 275-306.
Oka A (1910) Key to Japanese leeches. Dobutsugaku Zasshi 22: 56-64.
Oka A (1910) Key to Japanese leeches. Dobutsugaku Zasshi 22: 56-64.
Pawłowski LK (1962) O występowaniu pijawki Erpobdella octoculata (L.) w Japonii. Zeszyty Naukowe Uniwersytetu Łódzkiego Nauki Matematiczno-przyrodnicze Seria II 12: 127-136.
Pawłowski LK (1962) O występowaniu pijawki Erpobdella octoculata (L.) w Japonii. Zeszyty Naukowe Uniwersytetu Łódzkiego Nauki Matematiczno-przyrodnicze Seria II 12: 127-136.
Rambaut A, Drummond AJ (2009) Tracer. 1.5: http://tree.bio.ed.ac.uk/software/tracer/
Rambaut A, Drummond AJ (2009) Tracer. 1.5: http://tree.bio.ed.ac.uk/software/tracer/
Richardson LR (1971) Gastrostomobdellidae f. nov. and a new genus for the gastroporous Orobdella octonaria Oka, 1895, of Japan (Hirudinoidea: Arhynchobdellae). Bulletin of the National Science Museum (Tokyo) 14: 585-602.
Richardson LR (1971) Gastrostomobdellidae f. nov. and a new genus for the gastroporous Orobdella octonaria Oka, 1895, of Japan (Hirudinoidea: Arhynchobdellae). Bulletin of the National Science Museum (Tokyo) 14: 585-602.
Richardson LR (1975) A new species of terricolous leeches in Japan (Gastrostomobdellidae, Orobdella). Bulletin of the National Science Museum Series A (Zoology) 1: 39-56.
Richardson LR (1975) A new species of terricolous leeches in Japan (Gastrostomobdellidae, Orobdella). Bulletin of the National Science Museum Series A (Zoology) 1: 39-56.
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. doi: 10.1093/bioinformatics/btg180
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. doi: 10.1093/bioinformatics/btg180
Sawyer RT (1986) Leech Biology and Behaviour. Clarendon Press, Oxford, 1065 pp.
Sawyer RT (1986) Leech Biology and Behaviour. Clarendon Press, Oxford, 1065 pp.
Schwarz G (1978) Estimating the dimension of a model. The Annals of Statistics 6: 461-464.doi: 10.1214/aos/1176344136
Schwarz G (1978) Estimating the dimension of a model. The Annals of Statistics 6: 461-464.doi: 10.1214/aos/1176344136
Tabei Y, Kiryu H, Kin T, Asai K (2008) A fast structural multiple alignment method for long RNA sequences. BMC Bioinformatics 9: 33. doi: 10.1186/1471-2105-9-33
Tabei Y, Kiryu H, Kin T, Asai K (2008) A fast structural multiple alignment method for long RNA sequences. BMC Bioinformatics 9: 33. doi: 10.1186/1471-2105-9-33
Tanabe AS (2008) Phylogears. 2.0: http://www.fifthdimension.jp/
Tanabe AS (2008) Phylogears. 2.0: http://www.fifthdimension.jp/
Tanabe AS (2011) Kakusan4 and Aminosan: two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Molecular Ecology Resources 11: 914-921. doi: 10.1111/j.1755-0998.2011.03021.x
Tanabe AS (2011) Kakusan4 and Aminosan: two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Molecular Ecology Resources 11: 914-921. doi: 10.1111/j.1755-0998.2011.03021.x
Toda M, Shokita S, Nishida M (2003) Origin of the Ryukyu Biota. In: Nishida M, Shikatani N, Shokita S (Eds). The Flora and Fauna of Inland Waters in the Ryukyu Islands. Tokai University Press, Hadano: 25-32.
Toda M, Shokita S, Nishida M (2003) Origin of the Ryukyu Biota. In: Nishida M, Shikatani N, Shokita S (Eds). The Flora and Fauna of Inland Waters in the Ryukyu Islands. Tokai University Press, Hadano: 25-32.
Whitman CO (1886) The leeches of Japan. Quarterly Journal of Microscopical Science New Series 26: 317-416.
Whitman CO (1886) The leeches of Japan. Quarterly Journal of Microscopical Science New Series 26: 317-416.